Materiały


Przygotowanie próbki do skorzystania z bazy danych:
 

Wyizolowane DNA należy poddać reakcji PCR umożliwiającej amplifikacje fragmentu jądrowego genu rodopsyny (RH1) w oparciu o startery Rod-F2W oraz Rod-R4n, opublikowanym w pracy

Sevilla, R.G., Diez, A., Noren, M., Mouchel, O., Jerome, M., Verrez-Bagnis, V., van Pelt, H., Favre-Krey, L., Krey, G., The Fishtrace Consortium & Bautista, J.M. 2007 Primers and polymerase chain reaction conditions for DNA barcoding teleost fish based on the mitochondrial cytochrome b and nuclear rhodopsin genes. Mol. Ecol. Notes 7, 730-734

Sekwencje starterów:

Rod-F2w: AGCAACTTCCGCTTCGGTGAGAA

Rod-R4n: GGAACTGCTTGTTCATGCAGATGTAGAT

Profil termiczny reakcji:

  • 94°C przez 5min
  • 30 cykli denaturacji (94°C,45s), przyłączanie starterów (62°C, 30s x 7 oraz 59°C, 30s x 27), wydłużanie starterów (72°C, 20s)
  • wydłużanie końcowe 72°C przez 7min

Skład mieszaniny reakcyjnej;

  • REDTaq ReadyMix 12,5 µl,
  • starter F 0,5 µl (10pmol/ µl),
  • starter R 0,5 µl (10pmol/ µl),
  • H2O DEPC 10,5 µl,
  • DNA 1 µl.

Zgodność analizowanej sekwencji z sekwencją zamieszczoną w bazie danych wystąpi tylko przy uzyskaniu pełnego produktu o długości 460 pz. Krótsze sekwencje lub sekwencje nieoczyszczone nie znajdą zastosowania w weryfikacji wyniku przy wykorzystaniu niniejszej bazy.